TAILIEUCHUNG - Cloning 101: A Primer

Once you have your restriction enzymes chosen, it is time to design the final complete gene The multiple cloning site (or whatever plasmid you are cloning into) should already have the 5’ portion of the gene intact (. RBS, spacer, Met) Sequences must be in frame | Ghosh Lab University of Arizona Department of Chemistry Cloning 101: A Primer Outline Cloning overview pDRAW32 Design Gene Insert Primers Further considerations (optimization of the process) Transformation Cloning Overview Four main steps in cloning: Insert synthesis Restriction enzyme digest Ligation Transformation + Functional construct Plasmid (vector) Insert (your gene) Design Overview Steps to follow in designing your cloning experiment: Design your gene Design your insert Pick your enzymes Check your design Recheck your design Functional construct All of the important information in one place! pDRAW32 Plasmid maps: pDRAW32 pDRAW32 You can look at the sequence in detail Open reading frames Translation Restriction sites Complementary strand Design of the Gene Example, the gene we want: G C D R A S P Y C G We got this from phage display: ggctgcgacagggcgagcccgtactgcggt G C D R A S P Y C G Phage sequence Final sequence for the gene of interest: ggctgcgacagggcgagcccgtactgcggttaa G C D

• Sinh học
• Design
• Insert Primers
• Cloning Overview
• Design of the Gene
• Blunt vs Sticky Ends
• Principles of degital design
• Principles degital design
• Degital design
• Digital design
• Documentation digital design
• Learn digital design
• Method of digital design
• logic design
• web design
• techniques for computer
• optimization techniques
• engineering design
• design methods
• design data
• Design Creativity
• Design Education
• Design Image
• Design Synthesis
• Design Computing
• Moving to design
• Lecture Moving to design
• Understanding the elements of design
• Moving from analysis to design
• Design and integrate the network
• Design the application architecture
• Sequential circuit design
• RTL hardware design
• Digital system design
• Thiết kế hệ thống kỹ thuật số
• Lecture RTL hardware design
• Hardware design
• Register transfer level
• Hierarchical design
• Steel design guide 1
• Base plate and anchor rod design
• Anchor rod design
• Column base plate connections
• Design examples
• Design of column base plate connections
• Lecture Top Down Network Design
• Top Down Network Design
• Bài giảng Thiết kế mạng
• Documenting your network design
• Documenting your design
• Design requirements
• Hướng dẫn học OptiSys Design
• Cách sử dụng OptiSys Design
• Làm quen với OptiSys Design
• Cách sử dụng phần mềm OptiSys Design
• Tìm hiểu về OptiSys Design
• Tài liệu về OptiSys Design
• The mechanical design process
• Why study the design process
• Understanding mechanical design
• Designers and design teams
• The design process
• Planning for design
• Lecture Game design
• Bài giảng thiết kế Game
• Hud and icon design
• Heads up in game design
• Health bar in game design
• Icon in game design
• Power Design 11
• sử dụng Power Design 11
• ứng dụng của Power Design 11
• tài liệu về Power Design 11
• các dùng Power Design 11
• aircraft design
• engine design
• design drawings
• aircraft engines
• systems design
• design planning
• Systems Analysis
• Design in a Changing World
• Analysis objectives
• design Objectives
• Fashion design basics
• Principles of fashion design
• Fashion design elements
• Fashion design presentation
• Fashion design process
• technology and living
• Fashion design basic
• Device Technologies
• Principles digital design
• Practice digital design
• Combinational logic design practices
• Sequential logic design pringciples
• Software design
• Software design and architecture
• Software architecture
• Software architectural design
• Object oriented design
• Software development
• Software design methods
• Engineering drawing
• Lecture Engineering drawing and design
• Engineering design process
• Mechanical design process
• Problem definition
• Alternative solutions
• Satellite hinge
• Mechanical design
• Preliminary design
• Mechanical systems