Đang chuẩn bị nút TẢI XUỐNG, xin hãy chờ
Tải xuống
Clear and concise, this easy-to-use text offers an introductory course on the language of gene cloning, covering microbial, plant, and animal systems. The essential concepts in biology relevant to the understanding of gene cloning are presented in a well-organized and accessible manner. This updated version of the first edition is an invaluable book for nonscientists as well as scientists with little background knowledge in gene cloning, providing a wealth of information for anyone wishing to gain proficiency in reading and speaking the language of gene cloning | The ABCs HHGene Clonira cosBBhmw TAA pCGTGGGTGdQyO G 1 CAGGGG1 Dominic W.S. Wong Springer ATCCGGCGAGTTTCTTTAAAi The ABCs of Gene Cloning Dominic w.s. Wong The ABCs of Gene Cloning Second Edition .
