TAILIEUCHUNG - Salmonella A Diversified Superbug Part 19

Tham khảo tài liệu 'salmonella a diversified superbug part 19', khoa học tự nhiên, công nghệ sinh học phục vụ nhu cầu học tập, nghiên cứu và làm việc hiệu quả | 528 Salmonella - A Diversified Superbug PFGE of s. Virchow The protocol for PFGE was based on that of Maslow et al. 1993 as modified by Ross Heuzenroeder 2005 . Agarose-embedded Salmonella DNA and the Staphylococcus aureus strain NCTC 8325 marker DNA Tenover et al. 1995 were digested overnight with the restriction endonucleases XbaI and SmaI respectively New England BioLabs Beverley MA . The PFGE running conditions in the BIO-RAD CHEF-DR III System and subsequent comparisons of band profiles were undertaken as described previously Ross Heuzenroeder 2005 using the GELCOMPAR II program Applied Maths . Data analysis Comparison of the discriminatory power of all typing methods was undertaken using Simpson s index of diversity Hunter Gaston 1988 . V08 V12 V14 V16 1000bp 500bp ES18 PCP locus Fig. 2. DOP-PCR amplified phage DNA from S. Virchow isolates V08 V12 V14 and V16 . Individual bands were excised cloned and sequenced to identify phage see text for details . Phage from S. Virchow isolate V08 contained Fels2 sequences V14 contained sequences from phage ES18 and V16 contained phage sequences from P186. The band containing the ES18 portal capsid protein sequence PCP is indicated as an example. No phage sequence was analysed from isolate V12 at time of publication. Molecular weight marker first and last lanes is a 100kb ladder. Table 2. Primers for MAPLT analysis of s. Virchow Phage Gene or locus Encoded proteins Primers Location infragment Sizes bp genomes P22 niriB ninB protein ES18 gene 9 putative coat protein Fels2 STM2736 CII protein Gifsy-1 STM2608 Terminase large subunit 186 ell CII protein 18b gene p Endolysin ST64B SB04 Putative portal protein P7 sit Putative injection transglyosylase V16 i Possible tail fibre protein ninBFl AACCTTTGAAATTCGATCTCCAGC ninBRl CTTCGTCTGACCACTTAACGC PCPF TGGAACGCACAGCATGATGC PCPR GGACTGCACCTGAATATTCGG Fels2cIIF TGTATGGAAACGGCAGCCAG Fels2cIIR GTCACAACATGGCGAAGCTG GtfsylAF GATCACGCATCCATTATGTTCAC GtfsylAR .

TÀI LIỆU LIÊN QUAN
TỪ KHÓA LIÊN QUAN
TAILIEUCHUNG - Chia sẻ tài liệu không giới hạn
Địa chỉ : 444 Hoang Hoa Tham, Hanoi, Viet Nam
Website : tailieuchung.com
Email : tailieuchung20@gmail.com
Tailieuchung.com là thư viện tài liệu trực tuyến, nơi chia sẽ trao đổi hàng triệu tài liệu như luận văn đồ án, sách, giáo trình, đề thi.
Chúng tôi không chịu trách nhiệm liên quan đến các vấn đề bản quyền nội dung tài liệu được thành viên tự nguyện đăng tải lên, nếu phát hiện thấy tài liệu xấu hoặc tài liệu có bản quyền xin hãy email cho chúng tôi.
Đã phát hiện trình chặn quảng cáo AdBlock
Trang web này phụ thuộc vào doanh thu từ số lần hiển thị quảng cáo để tồn tại. Vui lòng tắt trình chặn quảng cáo của bạn hoặc tạm dừng tính năng chặn quảng cáo cho trang web này.